-
PurposeExpresses ZIM3 KRAB domain fused to PYL1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX301
-
Backbone manufacturerDavid Root lab; Addgene plasmid #25895
- Total vector size (bp) 8924
-
Modifications to backbonePYL1 inserted to the 3' end of the Gateway cassette
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow at 30 degrees to avoid recombination
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZIM3
-
SpeciesH. sapiens (human)
-
MutationIncludes ZIM3 aa 1-100
-
Entrez GeneZIM3 (a.k.a. ZNF264, ZNF657)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX301-ZIM3-KRAB-PYL1 was a gift from Mikko Taipale (Addgene plasmid # 154761 ; http://n2t.net/addgene:154761 ; RRID:Addgene_154761) -
For your References section:
An efficient KRAB domain for CRISPRi applications in human cells. Alerasool N, Segal D, Lee H, Taipale M. Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5. 10.1038/s41592-020-0966-x PubMed 33020655