pLX303-ZIM3-KRAB-dCas9
(Plasmid #154472)

• Purpose: Expresses ZIM3 KRAB domain fused to the N terminus of dCas9
• Depositing Lab: Mikko Taipale
• Publication: Alerasool et al Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5.

Backbone

• Vector backbone: pLX303
• Backbone manufacturer: David Root
• Total vector size (bp): 12279
• Modifications to backbone: dCas9 construct after Gateway recombination sites (C-terminal to the insert)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow at 30 degrees to avoid recombination
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZIM3
• Species: Synthetic
• Mutation: Includes ZIM3 aa 1-100
• Entrez Gene: ZIM3 (a.k.a. ZNF264, ZNF657)
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pLX303-ZIM3-KRAB-dCas9.gb
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry