pMG046 pETARA-CK1α-His
(Plasmid #154074)

• Purpose: Expresses GST_CK1α (human CK1α as a fusion protein with GST and His- tags) in E.coli
• Depositing Lab: Jesse Zalatan
• Publication: Gavagan et al Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17.

Backbone

• Vector backbone: pETARA
• Backbone size w/o insert (bp): 4354
• Total vector size (bp): 5365
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CSNK1A1
• Alt name: Casein kinase I isoform alpha
• Species: H. sapiens (human)
• Insert Size (bp): 1011
• Entrez Gene: CSNK1A1 (a.k.a. CK1, CK1a, CKIa, HEL-S-77p, HLCDGP1, PRO2975)
• Promoter: T7
• Tags / Fusion Proteins:
  • GST (N terminal on backbone)
  • His6 (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: T7 Reverse GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pMG046_pETARA_hCK1alpha.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene #92014

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry