-
PurposeDimerization dependent fluorescent protein GB core domain fused to mRNA decapping enzyme 1b
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepACGFP-c1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 6506
-
Modifications to backboneGFP was replaced with GB using NheI and BspEI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRNA decapping enzyme 1b
-
Alt nameDcp1b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1854
-
Entrez GeneDCP1B (a.k.a. DCP1)
-
Tag
/ Fusion Protein
- pAcGFP-C1 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATCACCTCCCACAACGAGG
- 3′ sequencing primer GGTGTGGGAGGTTTTTTAAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GB-Dcp1b was a gift from Gia Voeltz (Addgene plasmid # 153979 ; http://n2t.net/addgene:153979 ; RRID:Addgene_153979) -
For your References section:
Endoplasmic reticulum contact sites regulate the dynamics of membraneless organelles. Lee JE, Cathey PI, Wu H, Parker R, Voeltz GK. Science. 2020 Jan 31;367(6477). pii: 367/6477/eaay7108. doi: 10.1126/science.aay7108. 10.1126/science.aay7108 PubMed 32001628