RA-Sec61β
(Plasmid #153978)

• Purpose: Dimerization dependent fluorescent protein RA domain fused to ER protein Sec61β
• Depositing Lab: Gia Voeltz
• Publication: Lee et al Science. 2020 Jan 31;367(6477). pii: 367/6477/eaay7108. doi: 10.1126/science.aay7108.

Backbone

• Vector backbone: pACGFP-c1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 4858
• Modifications to backbone: GFP replaced with RA tag using NheI and BspEI
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Sec61 Transolocon Subunit Beta
• Alt name: Sec61β
• Species: H. sapiens (human)
• Insert Size (bp): 291
• Entrez Gene: SEC61B
• Tag / Fusion Protein:
  • pAcGFP-C1 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CATCACCTCCCACAACGAGG
• 3′ sequencing primer: GGTGTGGGAGGTTTTTTAAAGC

Resource Information

• Supplemental Documents:
  • RA-Sec61B.gbk
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry