AAV-EF1α1.1-SomArchon-GFP
(Plasmid
#153531)
-
PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV- EF1α1.1
-
Backbone manufacturerEpoch
- Backbone size w/o insert (bp) 4974
- Total vector size (bp) 6798
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSomArchon-GFP
-
Insert Size (bp)1824
-
GenBank IDMN091368.1
- Promoter EF1α1.1
-
Tags
/ Fusion Proteins
- KGC (C terminal on insert)
- GFP (C terminal on insert)
- ER2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggatcttggttcattctcaag
- 3′ sequencing primer aaagagacagcaaccagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EF1α1.1-SomArchon-GFP was a gift from Edward Boyden (Addgene plasmid # 153531 ; http://n2t.net/addgene:153531 ; RRID:Addgene_153531) -
For your References section:
Population imaging of neural activity in awake behaving mice. Piatkevich KD, Bensussen S, Tseng HA, Shroff SN, Lopez-Huerta VG, Park D, Jung EE, Shemesh OA, Straub C, Gritton HJ, Romano MF, Costa E, Sabatini BL, Fu Z, Boyden ES, Han X. Nature. 2019 Oct;574(7778):413-417. doi: 10.1038/s41586-019-1641-1. Epub 2019 Oct 9. 10.1038/s41586-019-1641-1 PubMed 31597963