pLVX-EF1α-BHLHE40-IRES-ZsGreen1
(Plasmid
#153061)
-
PurposeLentiviral vector expressing human BHLHE40
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX-EF1α-IRES-ZsGreen1
- Backbone size w/o insert (bp) 8871
- Total vector size (bp) 10116
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBHLHE40
-
Alt nameDec1
-
Alt nameStra13
-
Alt nameSharp2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1245
-
Entrez GeneBHLHE40 (a.k.a. BHLHB2, Clast5, DEC1, HLHB2, SHARP-2, SHARP2, STRA13, Stra14)
- Promoter EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TTCCATTTCAGGTGTCGTGA
- 3′ sequencing primer ACACCGGCCTTATTCCAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-EF1α-BHLHE40-IRES-ZsGreen1 was a gift from Silvia Monticelli (Addgene plasmid # 153061 ; http://n2t.net/addgene:153061 ; RRID:Addgene_153061) -
For your References section:
A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878