RCAS DNhRARalpha (CC#1865)
(Plasmid #15153)

• Depositing Lab: Connie Cepko
• Publication: Sen et al Development. 2005 Dec . 132(23):5147-59.

Backbone

• Vector backbone: RCASBP (A)
• Backbone size w/o insert (bp): 11600
• Vector type: Retroviral ; Avian expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RAR alpha (dom neg)
• Alt name: RARa
• Species: H. sapiens (human)
• Mutation: Dominant negative. Truncated at aa403, so lacks the C-terminal transcriptional activation domain.
• Entrez Gene: RARA (a.k.a. NR1B1, RAR, RARalpha)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: n/a

Resource Information

• A portion of this plasmid was derived from a plasmid made by: RAR alpha provided by Dr. Ronald Evans.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

RARa was PCR-amplified using GCAGAAGACCCCATGGCCAGCAACAGCAGCTCCT as the 5' primer and CCGGAATTCCAACATTTCCTGGATGAGAGGCGG as the 3' primer. The PCR product was digested with BbsI and EcoRI, and subcloned into the NcoI/EcoRI sites of pSlax21 to generate pSlax21-DNhRAR. The ClaI fragment of pSlax21-DNhRAR was then subcloned into the RCASBP(A) vector.