Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RCAS DNhRARalpha (CC#1865)
(Plasmid #15153)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15153 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    RCASBP (A)
  • Backbone size w/o insert (bp) 11600
  • Vector type
    Retroviral ; Avian expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RAR alpha (dom neg)
  • Alt name
    RARa
  • Species
    H. sapiens (human)
  • Mutation
    Dominant negative. Truncated at aa403, so lacks the C-terminal transcriptional activation domain.
  • Entrez Gene
    RARA (a.k.a. NR1B1, RAR, RARalpha)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    RAR alpha provided by Dr. Ronald Evans.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

RARa was PCR-amplified using GCAGAAGACCCCATGGCCAGCAACAGCAGCTCCT as the 5' primer and CCGGAATTCCAACATTTCCTGGATGAGAGGCGG as the 3' primer. The PCR product was digested with BbsI and EcoRI, and subcloned into the NcoI/EcoRI sites of pSlax21 to generate pSlax21-DNhRAR. The ClaI fragment of pSlax21-DNhRAR was then subcloned into the RCASBP(A) vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCAS DNhRARalpha (CC#1865) was a gift from Connie Cepko (Addgene plasmid # 15153 ; http://n2t.net/addgene:15153 ; RRID:Addgene_15153)
  • For your References section:

    Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina. Sen J, Harpavat S, Peters MA, Cepko CL. Development. 2005 Dec . 132(23):5147-59. 10.1242/dev.02100 PubMed 16251210