Skip to main content
Addgene

pTCO2-mTDGi.0
(Plasmid #149429)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149429 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTCO2 (Addgene Plasmid #149428)
  • Backbone manufacturer
    Primo Schär Lab
  • Backbone size w/o insert (bp) 13769
  • Total vector size (bp) 15673
  • Vector type
    Mammalian Expression, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tdg
  • Alt name
    miniTdg gene
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1945
  • Mutation
    SNPs of the Tdg gene from the OLA/129 strain
  • GenBank ID
    NM_172552.4 NM_011561.3
  • Entrez Gene
    Tdg (a.k.a. E130317C12Rik, JZA-3, Jza, Jza1)
  • Promoter Tdg promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer AGCAGCGTGGGAGGGG
  • 3′ sequencing primer TCCGTCCTGAGGTCTGCATTAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTCO2-mTDGi.0 was a gift from Primo Schaer (Addgene plasmid # 149429 ; http://n2t.net/addgene:149429 ; RRID:Addgene_149429)

  • For your References section:

    Inducible TDG knockout models to study epigenetic regulation. Schwarz SD, Grundbacher E, Hrovat AM, Xu J, Kusnierczyk A, Vagbo CB, Schar P, Schuermann D. F1000Res. 2020 Sep 9;9:1112. doi: 10.12688/f1000research.25637.2. eCollection 2020. 10.12688/f1000research.25637.2 PubMed 33082936
Related items:
Commonly requested with: