pEAK-bKal7
(Plasmid
#145800)
-
Purposeexpresses Kalirin-7 with the b-front in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEAK
-
Backbone manufacturerEdge Biosystems
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 11000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebKalirin-7
-
Alt namebKal7
-
Alt nameKa7b
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)5000
-
GenBank IDU88156.1
-
Entrez GeneKalrn (a.k.a. Duo, Hapip, Kalirin)
- Promoter EIF2a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (destroyed during cloning)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer CTGGGCTGGCTTACCTGCGGCCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEAK-bKal7 was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145800 ; http://n2t.net/addgene:145800 ; RRID:Addgene_145800) -
For your References section:
Alternate promoter usage generates two subpopulations of the neuronal RhoGEF Kalirin-7. Miller MB, Yan Y, Wu Y, Hao B, Mains RE, Eipper BA. J Neurochem. 2017 Mar;140(6):889-902. doi: 10.1111/jnc.13749. Epub 2016 Sep 6. 10.1111/jnc.13749 PubMed 27465683