pEAK-cKal7
(Plasmid #145801)

• Purpose: expresses Kalirin-7 with the c-front in mammalian cells
• Depositing Labs: Betty Eipper, Richard Mains
• Publication: Miller et al J Neurochem. 2017 Mar;140(6):889-902. doi: 10.1111/jnc.13749. Epub 2016 Sep 6.

Backbone

• Vector backbone: pEAK
• Backbone manufacturer: Edge Biosystems
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 11200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cKalirin-7
• Alt name: cKal7
• Alt name: Kal7c
• Species: R. norvegicus (rat)
• Insert Size (bp): 5000
• GenBank ID: AF230644.1
• Entrez Gene: Kalrn (a.k.a. Duo, Hapip, Kalirin)
• Promoter: EIF2a
• Tag / Fusion Protein:
  • none (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nco1 (destroyed during cloning)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: CAAGCCTCAGACAGTGGTTCAAAG
• 3′ sequencing primer: CTGGGCTGGCTTACCTGCGGCCGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry