pHelper-T7IS1
(Plasmid
#140631)
-
PurposeExpresses ShCAST under the T7 promoter and an empty sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression, CRISPR ; Transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA targeting IS1 (Escherichia coli)
-
gRNA/shRNA sequencettttatgttcagataatgcccgat
-
SpeciesScytonema hofmanni
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHelper-T7IS1 was a gift from Sheng Yang (Addgene plasmid # 140631 ; http://n2t.net/addgene:140631 ; RRID:Addgene_140631) -
For your References section:
Multicopy chromosomal integration using CRISPR-associated transposases. Zhang Y, Sun X, Wang Q, Xu J, Dong F, Yang S, Yang J, Zhang Z, Qian Y, Chen J, Zhang J, Liu Y, Tao R, Jiang Y, Yang J, Yang S. ACS Synth Biol. 2020 Jun 17. doi: 10.1021/acssynbio.0c00073. 10.1021/acssynbio.0c00073 PubMed 32551502