Skip to main content
Addgene

pLenti-PGK-Venus-Fluc (puro)
(Plasmid #140328)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140328 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti PGK Puro DEST (Addgene #19068)
  • Backbone manufacturer
    Eric Campeau & Paul Kaufman
  • Backbone size w/o insert (bp) 9599
  • Total vector size (bp) 10372
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus-Firefly Luciferase (luc2)
  • Species
    Synthetic; Aequorea victoria (Venus) and Photinus pyralis (luciferase)
  • Insert Size (bp)
    2400
  • Promoter human PGK promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer hPGK-F GTGTTCCGCATTCTGCAAG
  • 3′ sequencing primer WPRE-R catagcgtaaaaggagcaaca
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Firefly luciferase gene was retrieved from Addgene plasmid MSCV-Fluc PGK-hygro (Addgene #18782) and added in frame behind a Venus cDNA. The pLenti-PGK-Venus-Fluc is in its structure identical to pLenti-PGK-Venus-Akaluc (Addgene #124701), except the different Luciferase version.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-PGK-Venus-Fluc (puro) was a gift from Roland Friedel (Addgene plasmid # 140328 ; http://n2t.net/addgene:140328 ; RRID:Addgene_140328)

  • For your References section:

    Akaluc bioluminescence offers superior sensitivity to track in vivo glioma expansion. Bozec D, Sattiraju A, Bouras A, Jesu Raj JG, Rivera D, Huang Y, Junqueira Alves C, Tejero R, Tsankova NM, Zou H, Hadjipanayis C, Friedel RH. Neurooncol Adv. 2020 Oct 10;2(1):vdaa134. doi: 10.1093/noajnl/vdaa134. eCollection 2020 Jan-Dec. 10.1093/noajnl/vdaa134 PubMed 33241215
Related items:
Commonly requested with: