pSEVA421-Cas9tr
(Plasmid #138709)

• Purpose: Plasmid constitutively expressing the Cas9 nuclease and the non-coding tracrRNA from S. pyogenes
• Depositing Lab: Víctor de Lorenzo
• Publication: Velazquez et al ACS Synth Biol. 2019 Sep 20;8(9):2186-2193. doi: 10.1021/acssynbio.9b00293. Epub 2019 Sep 3.

Backbone

• Vector backbone: pSEVA421
• Backbone manufacturer: Standard European Vector Architecture
• Backbone size w/o insert (bp): 3882
• Total vector size (bp): 8506
• Modifications to backbone: tracrRNA-Cas9 was PCR amplified from pCas9 (Jiang et al, Nat Biotechnol 2013, 31, 233-239) and the 4.7 Kb fragment was cloned by Gibson Assembly in pSEVA421 restricted with SanDI/SwaI
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: tracrRNA-Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4644

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaacgctcggttgccgc
• 3′ sequencing primer: ctgcgtaacatcgttgctgctcca

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Aparicio T, de Lorenzo V, Martínez-García E (2018) CRISPR/Cas9-based counterselection boosts recombineering efficiency in Pseudomonas putida. Biotechnol J 13(5):1700161
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry