pACDura3
(Plasmid
#138711)
-
PurposeExpresses group II intron Ll.LtrB and IEP (LtrA) from Lactoccus lactis under control of T7 promoter. Ll.LtrB is retargeted to insert into 635s locus of LacZ gene and ura3 gene is cloned inside.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACD4K-C
-
Backbone manufacturerSigma-Aldrich
- Backbone size w/o insert (bp) 7675
- Total vector size (bp) 7264
-
Modifications to backboneFirst, retro-transposition-activated selectable marker (RAM) in pACD4K-C was excised by digestion with mluI enzyme. Then, optimized ura3 gene was amplified by PCR, digested with mluI and ligated with mluI-digested pACD4K-C vector.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameura3 gene
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)963
-
Mutationoptimized ura3 gene for expression in Escherichia coli
-
Entrez GeneURA3 (a.k.a. YEL021W)
- Promoter pEM7 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site mluI (not destroyed)
- 3′ cloning site mluI (not destroyed)
- 5′ sequencing primer ATGTCCAAGGCTACTTACAAGG
- 3′ sequencing primer ATGATAATATCAGAGCCGGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACDura3 was a gift from Víctor de Lorenzo (Addgene plasmid # 138711 ; http://n2t.net/addgene:138711 ; RRID:Addgene_138711) -
For your References section:
Recombination-Independent Genome Editing through CRISPR/Cas9-Enhanced TargeTron Delivery. Velazquez E, Lorenzo V, Al-Ramahi Y. ACS Synth Biol. 2019 Sep 20;8(9):2186-2193. doi: 10.1021/acssynbio.9b00293. Epub 2019 Sep 3. 10.1021/acssynbio.9b00293 PubMed 31419111