pGL4.24-Cd36-enhancer1
(Plasmid #138573)

• Purpose: Firefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17835541_17837355
• Depositing Lab: Lora Hooper
• Publication: Kuang et al Science. 2019 Sep 27;365(6460):1428-1434. doi: 10.1126/science.aaw3134.

Backbone

• Vector backbone: pGL4.24
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4411
• Total vector size (bp): 6246
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cd36 enhancer
• Species: M. musculus (mouse)
• Insert Size (bp): 1835
• GenBank ID: NC_000071.6
• Entrez Gene: Cd36 (a.k.a. FAT, GPIV, Scarb3)
• Promoter: Minimal promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: RVprimer3
• 3′ sequencing primer: TGGCTTTACCAACAGTACCGGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS found a 5bp t deletion in the Cd36-enhancer1 region. Depositor confirms this deletion does not affect plasmid function and they observed strong induction using the luciferase assay.