Skip to main content
Addgene

pAAV-synapsin-HaloCaMP1b-EGFP
(Plasmid #138328)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138328 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 138328-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV9 138328-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 6562
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloCaMP1b
  • Insert Size (bp)
    1554
  • Promoter synapsin
  • Tags / Fusion Proteins
    • Nuclear Exclusion Signal (N terminal on insert)
    • His-tag (N terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCACGCGAGGCGCGAGATAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Information for AAV1 (Catalog # 138328-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from pAAV-synapsin-HaloCaMP1b-EGFP (#138328). In addition to the viral particles, you will also receive purified pAAV-synapsin-HaloCaMP1b-EGFP plasmid DNA.

Synapsin-driven HaloCaMP1b, a far-red calcium sensor, fused to EGFP. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 138328-AAV9) ( Back to top)

Purpose

Ready-to-use AAV9 particles produced from pAAV-synapsin-HaloCaMP1b-EGFP (#138328). In addition to the viral particles, you will also receive purified pAAV-synapsin-HaloCaMP1b-EGFP plasmid DNA.

Synapsin-driven HaloCaMP1b, a far-red calcium sensor, fused to EGFP. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-synapsin-HaloCaMP1b-EGFP was a gift from Eric Schreiter (Addgene plasmid # 138328 ; http://n2t.net/addgene:138328 ; RRID:Addgene_138328) For viral preps, please replace (Addgene plasmid # 138328) in the above sentence with: (Addgene viral prep # 138328-AAV1) or (Addgene viral prep # 138328-AAV9)
  • For your References section:

    The HaloTag as a general scaffold for far-red tunable chemigenetic indicators. Deo C, Abdelfattah AS, Bhargava HK, Berro AJ, Falco N, Farrants H, Moeyaert B, Chupanova M, Lavis LD, Schreiter ER. Nat Chem Biol. 2021 Jun;17(6):718-723. doi: 10.1038/s41589-021-00775-w. Epub 2021 Apr 1. 10.1038/s41589-021-00775-w PubMed 33795886