pMDC32B-AtTAS1c-D2-B/c-AtMIR173
(Plasmid #137885)

• Purpose: Plant expression vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor downstream 3'D1[+]. Contains AtMIR173 for syntasi expression in any plant species.
• Depositing Lab: Alberto Carbonell
• Publication: Lopez-Dolz et al Nucleic Acids Res. 2020 May 12. pii: 5836195. doi: 10.1093/nar/gkaa343.

Backbone

• Vector backbone: pMDC32
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 10141
• Total vector size (bp): 14339
• Vector type: Plant Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: AtTAS1c-D2-B/c
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2451
• Mutation: A. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites downstream the 3'D1[+] position. The BsaI site in the ccdB gene was mutated to block the site.

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: AAACCTAAACCTAAACGGCTAAGC

Gene/Insert 2

• Gene/Insert name: 2x35S-AtMIR173-Tnos
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1747
• Mutation: AtMIR173 sequence with two nucleotide substitutions to block natural BsaI sites, flanked by the 2x35S promoter and Tnos terminator sequences

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: caccATAATTAGCAAGTAATAAGG
• 3′ sequencing primer: ATCTGTTATACAACCAAATCC

Resource Information

• Supplemental Documents:
  • pMDC32B-AtTAS1c-D2-Bc-AtMIR173.gb
  • Cloning protocol

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry