Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-dfROX
(Plasmid #137170)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137170 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSDM101
  • Backbone size w/o insert (bp) 11143
  • Total vector size (bp) 11974
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    HB101
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    roGFP2-2A-HyPer Red
  • Species
    Synthetic
  • Insert Size (bp)
    2208
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site Sali/BsaI (not destroyed)
  • 5′ sequencing primer pLV-Seq-F1: GTGTCGTGAGGAATTTCGAC
  • 3′ sequencing primer EGFP-C-forward: CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-dfROX was a gift from Shaun McCullough (Addgene plasmid # 137170 ; http://n2t.net/addgene:137170 ; RRID:Addgene_137170)
  • For your References section:

    Exposure Effects Beyond the Epithelial Barrier: Trans-Epithelial Induction of Oxidative Stress by Diesel Exhaust Particulates in Lung Fibroblasts in an Organotypic Human Airway Model. Faber SC, McNabb NA, Ariel P, Aungst ER, McCullough SD. Toxicol Sci. 2020 Jun 11. pii: 5856111. doi: 10.1093/toxsci/kfaa085. 10.1093/toxsci/kfaa085 PubMed 32525552