pLV-dfROX
(Plasmid #137170)

• Purpose: Lentiviral transfer vector for expression of roGFP2 and HyPer Red
• Depositing Lab: Shaun McCullough
• Publication: Faber et al Toxicol Sci. 2020 Jun 11. pii: 5856111. doi: 10.1093/toxsci/kfaa085.

Backbone

• Vector backbone: pSDM101
• Backbone size w/o insert (bp): 11143
• Total vector size (bp): 11974
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): HB101
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: roGFP2-2A-HyPer Red
• Species: Synthetic
• Insert Size (bp): 2208
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: Sali/BsaI (not destroyed)
• 5′ sequencing primer: pLV-Seq-F1: GTGTCGTGAGGAATTTCGAC
• 3′ sequencing primer: EGFP-C-forward: CATGGTCCTGCTGGAGTTCGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry