pAAV-Ef1a-sRGECO
(Plasmid #137125)

• Purpose: Viral expression of sRGECO
• Depositing Labs: Karl Deisseroth, INTRSECT 2.0 Project
• Publication: Fenno et al Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. doi: 10.1016/j.neuron.2020.06.003.

Backbone

• Vector backbone: AAV2-EF1a-WPRE
• Backbone size w/o insert (bp): 5300
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sRGECO
• Species: Synthetic; Prokaryotic
• Insert Size (bp): 1300
• Mutation: E217D
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: TGGAATTTGCCCTTTTTGAG
• 3′ sequencing primer: GGGCCACAACTCCTCATAAA

Resource Information

• Supplemental Documents:
  • pAAV-EF1a-sRGECO-WPRE.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for AAV8 (Catalog # 137125-AAV8)

Purpose

Ready-to-use AAV8 particles produced from pAAV-Ef1a-sRGECO (#137125). In addition to the viral particles, you will also receive purified pAAV-Ef1a-sRGECO plasmid DNA.

EF1a-driven expression of cytosolic sRGECO calcium sensor. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV8
• Purification: Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.