PLKO.1-UPF3A-3'UTR
(Plasmid
#136042)
-
PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePLKO.1
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUPF3A
-
gRNA/shRNA sequenceGACGTAGAAACACGCAGAAAC
-
SpeciesH. sapiens (human)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLKO.1-UPF3A-3'UTR was a gift from Anthony Leung (Addgene plasmid # 136042 ; http://n2t.net/addgene:136042 ; RRID:Addgene_136042) -
For your References section:
Structure-Mediated RNA Decay by UPF1 and G3BP1. Fischer JW, Busa VF, Shao Y, Leung AKL. Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi: 10.1016/j.molcel.2020.01.021. Epub 2020 Feb 3. 10.1016/j.molcel.2020.01.021 PubMed 32017897