pcDNA3-His:dCas9:nls:10P3
(Plasmid #135982)

• Purpose: Expresses dCas9 fused to 10 copies of the P3 coiled coil in mammalian cells
• Depositing Lab: Roman Jerala
• Publication: Lebar et al Nat Chem Biol. 2020 Jan 6. pii: 10.1038/s41589-019-0443-y. doi: 10.1038/s41589-019-0443-y.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: ThermoFisher
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 10792
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9 fused to 10 copies of the P3 coiled-coil
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 5376
• Mutation: D10A; H840A in S.pyogenes Cas9
• GenBank ID: WP_010922251.1
• Promoter: CMV
• Tag / Fusion Protein:
  • His (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pcDNA3-His:dCas9:nls:10P3
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry