pQadd1F
(Plasmid #135660)

• Purpose: Clostridial vector, encoding a targetron carrying two lox511/71 and loxFAS/66 sites in tandem in the forward (sense) orientation. Retarget intron to insert double-lox site onto genome at desired site.
• Depositing Lab: Andrew Tolonen
• Publication: Cerisy et al mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19.

Backbone

• Vector backbone: pAT19
• Backbone size w/o insert (bp): 6500
• Total vector size (bp): 10268
• Vector type: Bacterial Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Intron containing lox site
• Species: Synthetic
• GenBank ID:
• Promoter: pFer

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PaeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTTCCGGCTCGTATGTTGTG
• 3′ sequencing primer: TACATCACCGACGAGCAAGG

Resource Information

• Supplemental Documents:
  • pQadd1F_Addgene_135660.gbk
• A portion of this plasmid was derived from a plasmid made by: Intron from pQint (addgene 25819)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transcription of LtrB-derived group II intron is driven by the pFer promoter. Redesign intron to target gene using TargeTron or Clostron algorithms (links below), then clone by SOE-PCR or gene synthesis ligation between NdeI and BsrGI sites.

Intron redesign links

http://www.clostron.com/clostron1.php
http://www.targetrons.com/targetron_pLtrB.php

Reference for intron redesign

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. The ClosTron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods. 2007;70(3):452-464.

Perutka J, Wang W, Goerlitz D, Lambowitz AM. Use of Computer-designed Group II Introns to Disrupt Escherichia coli DExH / D-box Protein and DNA Helicase Genes. 2004:421-439.