pQlox71R
(Plasmid #135656)

• Purpose: Clostridial vector, encoding a targetron carrying a lox71 site in the reverse (antisense) orientation. Retarget intron to insert lox71 onto genome at desired site.
• Depositing Lab: Andrew Tolonen
• Publication: Cerisy et al mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19.

Backbone

• Vector backbone: pAT19
• Backbone size w/o insert (bp): 6500
• Total vector size (bp): 10208
• Vector type: Bacterial Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Intron containing lox site
• Species: Synthetic
• Insert Size (bp): 3507
• GenBank ID:
• Promoter: pFer

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PaeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTTCCGGCTCGTATGTTGTG
• 3′ sequencing primer: TACATCACCGACGAGCAAGG

Resource Information

• Supplemental Documents:
  • pQlox71R_Addgene_135656.gbk
• A portion of this plasmid was derived from a plasmid made by: Intron from pQint (addgene 25819)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use in combination with pQlox66F (addgene 135657) or pQlox 66R (addgene 135658), then pQcre1 (addgene 135659).

Transcription of LtrB-derived group II intron is driven by the pFer promoter. Redesign intron to target gene using TargeTron or Clostron algorithms (links below), then clone by SOE-PCR or gene synthesis ligation between NdeI and BsrGI sites.

Lox66 and Lox71 must be in same orientation to delete the intervening sequence, but the directions of introns relative to one another can generate inverted repeats in the chromosome after deletion has taken place, leading to futher recombinations events. See publication for details.

Intron redesign links

http://www.clostron.com/clostron1.php
http://www.targetrons.com/targetron_pLtrB.php

Reference for intron redesign

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. The ClosTron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods. 2007;70(3):452-464.

Perutka J, Wang W, Goerlitz D, Lambowitz AM. Use of Computer-designed Group II Introns to Disrupt Escherichia coli DExH / D-box Protein and DNA Helicase Genes. 2004:421-439.