pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
(Plasmid #135562)

• Purpose: An AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporter
• Depositing Lab: Christopher Richie
• Publication: Venniro et al Proc Natl Acad Sci U S A. 2020 Apr 7;117(14):8126-8134. doi: 10.1073/pnas.2001615117. Epub 2020 Mar 23.

Backbone

• Vector backbone: pscAAV CMV-IE Nuc-EYFP
• Backbone manufacturer: NIDA OTTC
• Backbone size w/o insert (bp): 4300
• Vector type: Mammalian Expression, AAV, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: shRNA (mouse PKCd)
• Alt name: mouse PKCd
• Species: M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): -1
• Promoter: mU6

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCtCGCACAGACTTGTGGGA

Gene/Insert 2

• Gene/Insert name: Nuc-EYFP
• Alt name: Yellow Fluorescent protein
• Insert Size (bp): 800
• Promoter: CMV-IE
• Tag / Fusion Protein:
  • 3xNLS (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pOTTC1534 - pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry