pAAV-Ef1a-Flex-Axon-GCaMP7b
(Plasmid #135419)

• Purpose: Can be used to drive axon-enriched expression of GCaMP7b in the presence of Cre recombinase.
• Depositing Lab: Rylan Larsen
• Publication: AAV GCaMP6 Plasmids (unpublished)

Backbone

• Vector backbone: pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
• Backbone manufacturer: Rylan Larsen (Allen Institute for Brain Science)
• Backbone size w/o insert (bp): 5897
• Total vector size (bp): 6662
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: axon-jGCaMP7b
• Alt name: Axon-GCaMP3 variant 1561
• Alt name: Axon-Janelia-GCaMP7b
• Species: R. norvegicus (rat), G. gallus (chicken); A. victoria
• Insert Size (bp): 1568
• Promoter: Ef1a
• Tags / Fusion Proteins:
  • GAP43 palmitoylation domain (N terminal on insert)
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: SwaI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • AAV_Ef1a_DIO_axon-GCaMP7b_WPRE3.gb
• A portion of this plasmid was derived from a plasmid made by: GCaMP7b was synthesized based on sequences published by Douglas Kim and the Janelia Research Campus in Dana et al, 2019 PMID:31209382 . The Axon(Gap43) targeting sequence fused to GCaMP7b was previously published by Lin Tian's lab in Broussard et al, 2018 PMID: PMC6697169.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry