pAAV-Ef1a-Flex-Axon-GCaMP7b
(Plasmid
#135419)
-
PurposeCan be used to drive axon-enriched expression of GCaMP7b in the presence of Cre recombinase.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
-
Backbone manufacturerRylan Larsen (Allen Institute for Brain Science)
- Backbone size w/o insert (bp) 5897
- Total vector size (bp) 6662
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameaxon-jGCaMP7b
-
Alt nameAxon-GCaMP3 variant 1561
-
Alt nameAxon-Janelia-GCaMP7b
-
SpeciesR. norvegicus (rat), G. gallus (chicken); A. victoria
-
Insert Size (bp)1568
- Promoter Ef1a
-
Tags
/ Fusion Proteins
- GAP43 palmitoylation domain (N terminal on insert)
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SwaI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGCaMP7b was synthesized based on sequences published by Douglas Kim and the Janelia Research Campus in Dana et al, 2019 PMID:31209382 . The Axon(Gap43) targeting sequence fused to GCaMP7b was previously published by Lin Tian's lab in Broussard et al, 2018 PMID: PMC6697169.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-Flex-Axon-GCaMP7b was a gift from Rylan Larsen (Addgene plasmid # 135419 ; http://n2t.net/addgene:135419 ; RRID:Addgene_135419)