pAAV-TRE-GCaMP6s
(Plasmid #135418)

• Purpose: Can be used to drive amplified GCaMP6s expression when combined with TET driver . Can be used to create adeno-associated virus to express TET-driven GCaMP6s.
• Depositing Lab: Rylan Larsen
• Publication: AAV GCaMP6 Plasmids (unpublished)

Backbone

• Vector backbone: pAAVTREGCaMP6f
• Backbone manufacturer: Tetsuo Yamamori
• Backbone size w/o insert (bp): 5830
• Total vector size (bp): 5765
• Modifications to backbone: A fragment containing GCaMP6s was swapped into replace GCaMP6f in the original backbone.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6s
• Alt name: GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
• Alt name: GCaMP3 variant 641
• Species: R. norvegicus (rat); A. victoria (jellyfish)
• Insert Size (bp): 1274
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NHEI (not destroyed)
• 5′ sequencing primer: TAGCGCCACCATGGTCGACTCA
• 3′ sequencing primer: GGATCCTTACTACTTCGCT

Resource Information

• Supplemental Documents:
  • pAAV-TRE-GCaMP6s.gb
• A portion of this plasmid was derived from a plasmid made by: GCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry