Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mLama1 AAV sgRNA 1, 2, 5
(Plasmid #135339)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135339 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX601
  • Backbone manufacturer
    Addgene (61591)
  • Backbone size w/o insert (bp) 3494
  • Total vector size (bp) 5600
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lama1 VP64-dCas9 sgRNA Guides
  • gRNA/shRNA sequence
    Laminin Alpha 1
  • Species
    M. musculus (mouse)
  • GenBank ID
    16773 16773
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer TCTAGTTGCCAGCCATCTGTTG
  • 3′ sequencing primer GGCGCGTACTATGGTTGCTTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mLama1 AAV sgRNA 1, 2, 5 was a gift from Ronald Cohn (Addgene plasmid # 135339 ; http://n2t.net/addgene:135339 ; RRID:Addgene_135339)
  • For your References section:

    A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene. Kemaladewi DU, Bassi PS, Erwood S, Al-Basha D, Gawlik KI, Lindsay K, Hyatt E, Kember R, Place KM, Marks RM, Durbeej M, Prescott SA, Ivakine EA, Cohn RD. Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24. 10.1038/s41586-019-1430-x PubMed 31341277