mLama1 AAV sgRNA 1, 2, 5
(Plasmid #135339)

• Purpose: Expression plasmid of VP64-SadCas9 sgRNA 1, 2 and 3
• Depositing Lab: Ronald Cohn
• Publication: Kemaladewi et al Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pX601
• Backbone manufacturer: Addgene (61591)
• Backbone size w/o insert (bp): 3494
• Total vector size (bp): 5600
• Modifications to backbone: None
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lama1 VP64-dCas9 sgRNA Guides
• gRNA/shRNA sequence: Laminin Alpha 1
• Species: M. musculus (mouse)
• GenBank ID: 16773 16773
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn1 (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: TCTAGTTGCCAGCCATCTGTTG
• 3′ sequencing primer: GGCGCGTACTATGGTTGCTTTG

Resource Information

• Supplemental Documents:
  • mLama1 AAV sgRNA 1, 2, 5.gb
• A portion of this plasmid was derived from a plasmid made by: N/A

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry