3XFLAG-VP64-SadCas9-NLS-VP64
(Plasmid #135338)

• Purpose: 3xFLAG 2xVP64 SadCas9 for single guide cloning
• Depositing Lab: Ronald Cohn
• Publication: Kemaladewi et al Nature. 2019 Aug;572(7767):125-130. doi: 10.1038/s41586-019-1430-x. Epub 2019 Jul 24.

Backbone

• Vector backbone: pX601
• Backbone manufacturer: Addgene (61591)
• Backbone size w/o insert (bp): 4010
• Total vector size (bp): 7667
• Modifications to backbone: None
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SadCas9
• Alt name: dSauCas9
• Alt name: dSaCas9
• Species: Staphylococcus aureus
• Insert Size (bp): 3405
• Mutation: D10A and N580A
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3xFLAG-VP64-SV40 NLS (N terminal on insert)
  • NLS-VP64 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGCACCAAAATCAACGGGACTTTC
• 3′ sequencing primer: CTTTCAAGTTACGGTAAG

Resource Information

• Supplemental Documents:
  • 3XFLAG-VP64_SadCas9_NLS_VP64.gb
• A portion of this plasmid was derived from a plasmid made by: N/A
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry