Skip to main content
Addgene

TPC2-mCherry
(Plasmid #135183)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135183 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLVXpuro
  • Backbone size w/o insert (bp) 8080
  • Total vector size (bp) 10990
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TPC2
  • Alt name
    Two-pore channel 2
  • Alt name
    Tpcn2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2193
  • GenBank ID
    BC141195
  • Entrez Gene
    Tpcn2 (a.k.a. D830047E22Rik, Gm35086)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer CCAGAGGCCACTTGTGTAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    IMAGE clone: 9055807 ImaGenes collection: IRCKp5014F1215Q Unknown

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IMAGE clone: 9055807
ImaGenes collection: IRCKp5014F1215Q
GeneBank: BC141195

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TPC2-mCherry was a gift from Antony Galione (Addgene plasmid # 135183 ; http://n2t.net/addgene:135183 ; RRID:Addgene_135183)
  • For your References section:

    Expression of Ca(2)(+)-permeable two-pore channels rescues NAADP signalling in TPC-deficient cells. Ruas M, Davis LC, Chen CC, Morgan AJ, Chuang KT, Walseth TF, Grimm C, Garnham C, Powell T, Platt N, Platt FM, Biel M, Wahl-Schott C, Parrington J, Galione A. EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14. 10.15252/embj.201490009 PubMed 25872774