TPC1-mCherry
(Plasmid #135182)

• Purpose: Expresses TPC1 with C-terminus mCherry tag in mammalian cells
• Depositing Lab: Antony Galione
• Publication: Ruas et al EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14.

Backbone

• Vector backbone: pLVXpuro
• Backbone size w/o insert (bp): 8080
• Total vector size (bp): 10750
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TPC1
• Alt name: Two-pore channel 1
• Alt name: Tpcn1
• Species: M. musculus (mouse)
• Insert Size (bp): 2433
• GenBank ID: BC058951
• Entrez Gene: Tpcn1 (a.k.a. 5730403B01Rik, Tpc1, mKIAA1169)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: CCAGAGGCCACTTGTGTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Unknown
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry