Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TPC1(ΔN69)-mCherry
(Plasmid #135184)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135184 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVXpuro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8080
  • Total vector size (bp) 10543
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TPC1
  • Alt name
    Two-pore channel 1
  • Alt name
    Tpcn1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2226
  • Mutation
    Deleted amino acids 1-69
  • GenBank ID
    BC058951
  • Entrez Gene
    Tpcn1 (a.k.a. 5730403B01Rik, Tpc1, mKIAA1169)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAA CGG GAC TTT CCA AAA TG
  • 3′ sequencing primer CCAGAGGCCACTTGTGTAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Unknown

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TPC1(ΔN69)-mCherry was a gift from Antony Galione (Addgene plasmid # 135184 ; http://n2t.net/addgene:135184 ; RRID:Addgene_135184)
  • For your References section:

    Expression of Ca(2)(+)-permeable two-pore channels rescues NAADP signalling in TPC-deficient cells. Ruas M, Davis LC, Chen CC, Morgan AJ, Chuang KT, Walseth TF, Grimm C, Garnham C, Powell T, Platt N, Platt FM, Biel M, Wahl-Schott C, Parrington J, Galione A. EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14. 10.15252/embj.201490009 PubMed 25872774