sg_shuttle_RFP657
(Plasmid #134968)

• Purpose: (Empty Backbone) Lentiviral vector for sgRNA expression
• Depositing Lab: Beat Bornhauser
• Publication: Huang et al Hemasphere. 2020 Sep 30;4(5):e456. doi: 10.1097/HS9.0000000000000456. eCollection 2020 Oct.

Backbone

• Vector backbone: pINDUCER21
• Backbone size (bp): 7458
• Modifications to backbone: The lentiviral backbone is derived from pINDUCER21 (Addgene #75159) and modified to express sgRNA and RFP657.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Promoter: U6-sgRNA; EFS-RFP657

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: In case of cloning multiple U6-sgRNA cassettes in one vector, grow the bacteria in 30°C.
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: gagggcctatttcccatgattc

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry