pFastbac1-Flag-FANCD2
(Plasmid #134904)

• Purpose: codon optimized expression and purification of human FANCD2 in insect cells using baculovirus
• Depositing Lab: Andrew Deans
• Publication: Tan et al PLoS One. 2020 Feb 24;15(2):e0229000. doi: 10.1371/journal.pone.0229000. eCollection 2020.

Backbone

• Vector backbone: pFastbac1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 9400
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FANCD2
• Alt name: Fanconi Anemia protein D2
• Species: H. sapiens (human)
• Insert Size (bp): 4413
• Mutation: fully synthetic, codon optimized for insect expression
• Entrez Gene: FANCD2 (a.k.a. FA-D2, FA4, FACD, FAD, FAD2, FANCD)
• Promoter: polyhedron
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TATTCCGGATTATTCATACC
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: fully synthetic gene, generated by Gene Universal

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For information regarding protein production from this plasmid, please see Tan et al, Plos One, 2020