TK-GFP-Nluc-P2A-neo-TK
(Plasmid #134896)

• Purpose: Expresses GFP protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum TK locus
• Depositing Lab: David Sibley
• Publication: Wilke et al Cell Host Microbe. 2019 Jun 18. pii: S1931-3128(19)30252-5. doi: 10.1016/j.chom.2019.05.007.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 2300
• Total vector size (bp): 8663
• Modifications to backbone: No
• Vector type: Cryptosporidium Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TK-GFP-Nluc-P2A-Neo-TK
• Species: Cryptosporidium parvum
• Insert Size (bp): 5961
• Promoter: Cryptosporidium actin and enolase

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: GAGCTCCATTTGTCCTAACTTCA
• 3′ sequencing primer: GGTACCCCTACCATAAGCATCA

Resource Information

• Supplemental Documents:
  • pTK-eGFP-Nluc-P2A-neo-TK.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry