PWPXLD-EGFR-WT
(Plasmid
#133749)
-
PurposeWild-type EGFR tagged with HA cloned into lentiviral PWPXLD plasimd
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePWPXLD
- Backbone size w/o insert (bp) 10455
- Total vector size (bp) 14088
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWild type EGFR-HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3633
-
GenBank IDNM_005228
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- HA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MLU1 (unknown if destroyed)
- 3′ cloning site SPE1 (unknown if destroyed)
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PWPXLD-EGFR-WT was a gift from Chay Kuo (Addgene plasmid # 133749 ; http://n2t.net/addgene:133749 ; RRID:Addgene_133749) -
For your References section:
EGFR Signaling Termination via Numb Trafficking in Ependymal Progenitors Controls Postnatal Neurogenic Niche Differentiation. Abdi K, Neves G, Pyun J, Kiziltug E, Ahrens A, Kuo CT. Cell Rep. 2019 Aug 20;28(8):2012-2022.e4. doi: 10.1016/j.celrep.2019.07.056. 10.1016/j.celrep.2019.07.056 PubMed 31433979