TfR-sfGFP-myc tag-SpyCatcher003
(Plasmid #133451)

• Purpose: Expresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detection
• Depositing Lab: Mark Howarth
• Publication: Keeble et al Proc Natl Acad Sci U S A. 2019 Dec 10. pii: 1909653116. doi: 10.1073/pnas.1909653116.

Backbone

• Vector backbone: pENTR4
• Backbone size w/o insert (bp): 4766
• Total vector size (bp): 6172
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TfR-sfGFP-myc tag-SpyCatcher003
• Species: Synthetic
• Insert Size (bp): 1410
• Mutation: Contains C20 and A23 mutations that improve plasma membrane display of the transferrin receptor (TfR)
• Promoter: CMV
• Tags / Fusion Proteins:
  • GSSGS (C terminal on insert)
  • myc tag

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: BGHFor (GACAGACTAACAGACTGTTCCTTTCC)
• 3′ sequencing primer: BGH reverse

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry