Skip to main content
Addgene

p-eGFP-beta 2 CP
(Plasmid #13298)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13298 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    p EGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    capping protein beta 2 subunit
  • Alt name
    actin capping protein
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1047
  • GenBank ID
    U10407
  • Entrez Gene
    Capzb (a.k.a. 1700120C01Rik, AI325129, CPB, CPB1, CPB2, CPbeat2, CPbet, CPbeta1, CPbeta2, Cap, Cappb1)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ECO R1 (unknown if destroyed)
  • 3′ cloning site Sac II (unknown if destroyed)
  • 5′ sequencing primer GENE SEQ cctcatcaggtccaaggcgcagtcc VECTOR SEQUENCE (CAT # 6479-1
  • 3′ sequencing primer GGTCACATAACAGTTTGCATC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-eGFP-beta 2 CP was a gift from John Cooper (Addgene plasmid # 13298 ; http://n2t.net/addgene:13298 ; RRID:Addgene_13298)

  • For your References section:

    Visualization and molecular analysis of actin assembly in living cells. Schafer DA, Welch MD, Machesky LM, Bridgman PC, Meyer SM, Cooper JA. J Cell Biol. 1998 Dec 28. 143(7):1919-30. 10.1083/jcb.143.7.1919 PubMed 9864364
Related items:
Commonly requested with: