pAM5505
(Plasmid #132664)

• Purpose: pRL623-based helper plasmid for conjugations, with RSF1010 mobA gene
• Depositing Lab: Susan Golden
• Publication: Bishe et al iScience. 2019 Oct 25;20:216-228. doi: 10.1016/j.isci.2019.09.002. Epub 2019 Sep 10.

Backbone

• Vector backbone: pRL623
• Backbone manufacturer: -
• Backbone size w/o insert (bp): 17500
• Total vector size (bp): 20000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MobA
• Species: RSF1010 plasmid
• Insert Size (bp): 2100
• Mutation: please see depositor comments below
• Promoter: p1,p3

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCCTACCGATGAATTCGAG
• 3′ sequencing primer: TAATTGACAACAGTTAGAAC

Resource Information

• Supplemental Documents:
  • pRL623_mobA_partial(theoretical).str
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene found mutations Q291P, P416T, P595S, H623D in mobA during our quality control process. The depositing lab confirmed these mutations do not affect plasmid function, and the plasmid functions as described in the associated publication.