pAM5411
(Plasmid
#132663)
-
PurposeRSF1010-based broad host-range plasmid with RK2 bom site and pUC origin expressing YFP and Sp/Sm resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAM5406
-
Backbone manufacturer-
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 9000
-
Modifications to backboneAddition of RK2-bom site, pUC19 origin of replication
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameaadA
-
Insert Size (bp)800
- Promoter PaadA
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGCCAAAAAAAAGCCCGCT
- 3′ sequencing primer TTCTCCTGCAGGGCCGAGTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameYFP
-
Insert Size (bp)720
- Promoter PconII
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGCCAAAAAAAAGCCCGCT
- 3′ sequencing primer TTCTCCTGCAGGGCCGAGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM5411 was a gift from Susan Golden (Addgene plasmid # 132663 ; http://n2t.net/addgene:132663 ; RRID:Addgene_132663) -
For your References section:
Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. Bishe B, Taton A, Golden JW. iScience. 2019 Oct 25;20:216-228. doi: 10.1016/j.isci.2019.09.002. Epub 2019 Sep 10. 10.1016/j.isci.2019.09.002 PubMed 31585408