pAM5409
(Plasmid #132662)

• Purpose: RSF1010-based broad host-range plasmid with RK2 bom site expressing YFP and Sp/Sm resistance
• Depositing Lab: Susan Golden
• Publication: Bishe et al iScience. 2019 Oct 25;20:216-228. doi: 10.1016/j.isci.2019.09.002. Epub 2019 Sep 10.

Backbone

• Vector backbone: pAM5404
• Backbone manufacturer: -
• Backbone size w/o insert (bp): 6300
• Total vector size (bp): 8300
• Modifications to backbone: Addition of RK2-bom site
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: aadA
• Insert Size (bp): 800
• Promoter: PaadA

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGCCAAAAAAAAGCCCGCT
• 3′ sequencing primer: AACTCGGCCCTGCAGGAGAA

Gene/Insert 2

• Gene/Insert name: YFP
• Insert Size (bp): 720
• Promoter: PconII

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGCCAAAAAAAAGCCCGCT
• 3′ sequencing primer: AACTCGGCCCTGCAGGAGAA

Resource Information

• Supplemental Documents:
  • pAM5409 Genbank
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry