Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMH1105
(Plasmid #131864)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131864 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDFDuet-1
  • Backbone manufacturer
    Novagen
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PhyB(1-651)-AviTag-His6
  • Alt name
    PhyB-AviTag
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2031
  • Promoter T7 promoter-1

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    HO1
  • Species
    Synechocystis PCC 6803
  • Insert Size (bp)
    723
  • Promoter T7 promoter-2

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    PcyA
  • Species
    Synechocystis PCC 6803
  • Insert Size (bp)
    747
  • Promoter T7 promoter-2

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH1105 was a gift from Wilfried Weber (Addgene plasmid # 131864 ; http://n2t.net/addgene:131864 ; RRID:Addgene_131864)
  • For your References section:

    Production, Purification and Characterization of Recombinant Biotinylated Phytochrome B for Extracellular Optogenetics. Horner M, Yousefi OS, Schamel WWA, Weber W. Bio Protoc. 2020 Mar 5;10(5):e3541. doi: 10.21769/BioProtoc.3541. eCollection 2020 Mar 5. 10.21769/BioProtoc.3541 PubMed 33659515