pTol2-CreLite
(Plasmid #131783)

• Purpose: Tol2 destination vector carrying Ubi:CreLite with mTagBFP2 as a visual marker.
• Depositing Lab: George Eisenhoffer
• Publication: Yen et al Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31.

Backbone

• Vector backbone: pzTol2
• Backbone manufacturer: VectorBuilder
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 10559
• Vector type: Mammalian Expression, Cre/Lox, Synthetic Biology ; Zebrafish Tol2 transposon

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PhyBCreC, PIF6CreN, and mTagBFP2
• Alt name: CreLite
• Species: A. thaliana (mustard weed), Synthetic; Bacteriophage P1, Entacmaea quadricolor
• Insert Size (bp): 3505
• GenBank ID: 816394 825382
• Promoter: Ubi
• Tag / Fusion Protein:
  • mTagBFP2

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: attB1: GTTTGTACAAAAAAGCAGGC
• 3′ sequencing primer: attB2: CCACTTTGTACAAGAAAGCTGGGT

Resource Information

• Supplemental Documents:
  • pTol2 CreLite.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.

This vector is designed by Dr. Shuo-Ting Yen from Eisenhoffer lab and synthesized by VectorBuilder.