Skip to main content
Addgene

pAAV-hSyn-mScarlet
(Plasmid #131001)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131001 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart
AAV1 131001-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
Add to Cart
AAV8 131001-AAV8 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405
Add to Cart

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mScarlet
  • Species
    Synthetic
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV1 (Catalog # 131001-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn-mScarlet (#131001). In addition to the viral particles, you will also receive purified pAAV-hSyn-mScarlet plasmid DNA.

Synapsin-driven mScarlet control vector. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mScarlet

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV8 (Catalog # 131001-AAV8) ( Back to top)

Purpose

Ready-to-use AAV8 particles produced from pAAV-hSyn-mScarlet (#131001). In addition to the viral particles, you will also receive purified pAAV-hSyn-mScarlet plasmid DNA.

Synapsin-driven mScarlet control vector. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mScarlet

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-mScarlet was a gift from Karl Deisseroth (Addgene plasmid # 131001 ; http://n2t.net/addgene:131001 ; RRID:Addgene_131001) For viral preps, please replace (Addgene plasmid # 131001) in the above sentence with: (Addgene viral prep # 131001-AAV1) or (Addgene viral prep # 131001-AAV8)

  • For your References section:

    Cortical layer-specific critical dynamics triggering perception. Marshel JH, Kim YS, Machado TA, Quirin S, Benson B, Kadmon J, Raja C, Chibukhchyan A, Ramakrishnan C, Inoue M, Shane JC, McKnight DJ, Yoshizawa S, Kato HE, Ganguli S, Deisseroth K. Science. 2019 Aug 9;365(6453). pii: science.aaw5202. doi: 10.1126/science.aaw5202. Epub 2019 Jul 18. 10.1126/science.aaw5202 PubMed 31320556
Related items:
Commonly requested with: