-
PurposeDouble floxed soma-targeted ChRmine-mScarlet under the control of Ef1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChRmine
-
SpeciesTiarina fusus
-
GenBank IDMN194599
- Promoter Ef1a
-
Tag
/ Fusion Protein
- mScarlet-Kv2.1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GTTAGGCCAGCTTGGCACTTG
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO-ChRmine-mScarlet-Kv2.1-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 130999 ; http://n2t.net/addgene:130999 ; RRID:Addgene_130999) -
For your References section:
Cortical layer-specific critical dynamics triggering perception. Marshel JH, Kim YS, Machado TA, Quirin S, Benson B, Kadmon J, Raja C, Chibukhchyan A, Ramakrishnan C, Inoue M, Shane JC, McKnight DJ, Yoshizawa S, Kato HE, Ganguli S, Deisseroth K. Science. 2019 Aug 9;365(6453). pii: science.aaw5202. doi: 10.1126/science.aaw5202. Epub 2019 Jul 18. 10.1126/science.aaw5202 PubMed 31320556