pLY133
(Plasmid
#130961)
-
PurposeEngineered sgRNA-LEB4 generator including Anderson promoter J23100 for golden gate assembly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB1K3mut
-
Backbone manufacturerDesigned by: Austin Che; Mutated by: unknown
- Backbone size w/o insert (bp) 2204
- Total vector size (bp) 2470
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCulture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-LEB4
-
gRNA/shRNA sequenceTGATCGTTCGGAAATAA
-
SpeciesSynthetic
- Promoter Anderson promoter J23100
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGCCACTTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Top10 bacterial strain should be used for downstream applications
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLY133 was a gift from Baojun Wang (Addgene plasmid # 130961 ; http://n2t.net/addgene:130961 ; RRID:Addgene_130961) -
For your References section:
Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria. Liu Y, Wan X, Wang B. Nat Commun. 2019 Aug 26;10(1):3693. doi: 10.1038/s41467-019-11479-0. 10.1038/s41467-019-11479-0 PubMed 31451697