pLenti-CMV-Blast-DNFGFR1-HA
(Plasmid #130887)

• Purpose: Expresses dominant negative mutant mouse FGFR1
• Depositing Lab: Gian-Paolo Dotto
• Publication: Bordignon et al Cell Rep. 2019 Aug 27;28(9):2358-2372.e6. doi: 10.1016/j.celrep.2019.07.092.

Backbone

• Vector backbone: pLenti CMV Blast DEST
• Backbone manufacturer: Eric Campeau & Paul Kaufman (Addgene plasmid # 17451)
• Backbone size w/o insert (bp): 9331
• Total vector size (bp): 8750
• Modifications to backbone: Gateway Cloning
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fgfr1
• Species: M. musculus (mouse)
• Insert Size (bp): 1002
• Mutation: Dominant Negative receptor lacking cytosolic catalytic domain. First 1002 bp of mouse Fgfr1c-isoform (variant 3, lacking immunoglobulin (Ig)-like domain I)
• GenBank ID: NM_001079909.2
• Entrez Gene: Fgfr1 (a.k.a. Eask, FGFR-I, FLG, Fgfr-1, Flt-2, Fr1, Hspy, MFR, bFGF-R-1, c-fgr)
• Tag / Fusion Protein:
  • HA-tag (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV Forward (CGCAAATGGGCGGTAGGCGTG)

Resource Information

• Supplemental Documents:
  • Protocol cloning DNFGFR1
• A portion of this plasmid was derived from a plasmid made by: Amplified from a plasmid received from Sabine Werner

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Werner, S., Weinberg, W., Liao, X., Peters, K., Blessing, M., Yuspa, S., Weiner, R., and Williams, L. (1993). Targeted expression of a dominant‐negative FGF receptor mutant in the epidermis of transgenic mice reveals a role of FGF in keratinocyte organization and differentiation. The EMBO Journal 12, 2635-2643.