ORF24-2xStrep pCDNA4
(Plasmid #129742)

• Purpose: Expresses KSHV ORF24 with Cterm 2xStrep tag in mammalian cells
• Depositing Lab: Britt Glaunsinger
• Publication: Castaneda et al J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18.

Backbone

• Vector backbone: pcDNA4/TO
• Backbone size w/o insert (bp): 5168
• Total vector size (bp): 7378
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ORF24
• Species: Kaposi's sarcoma-associated herpesvirus (HHV-8)
• Insert Size (bp): 2256
• GenBank ID: 4961485
• Entrez Gene: ORF24 (a.k.a. HHV8GK18_gp27)
• Promoter: CMV
• Tag / Fusion Protein:
  • 2xStrep Tag II (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: NotI (destroyed during cloning)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • ORF24-2xStrep pCDNA4
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry