pcDNA4/TO-ORF66-2xStrep
(Plasmid #130953)

• Purpose: Expresses KSHV ORF66 a.a. 1-429 (full length) with a C-terminal 2xStrep tag in mammalian cells
• Depositing Lab: Britt Glaunsinger
• Publication: Didychuk et al J Virol. 2019 Oct 2. pii: JVI.01299-19. doi: 10.1128/JVI.01299-19.

Backbone

• Vector backbone: pcDNA4/TO
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 5117
• Total vector size (bp): 6404
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ORF66
• Species: Kaposi's Sarcoma Associated Herpesvirus (HHV-8)
• Insert Size (bp): 1287
• Mutation: ORF66 a.a. 1-429 (full-length)
• Entrez Gene: ORF66 (a.k.a. HHV8GK18_gp75)
• Promoter: CMV
• Tag / Fusion Protein:
  • 2xStrep (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry