pB-MultiplexedReporter-MOR170-1
(Plasmid
#129461)
-
PurposepiggyBac transposon vector encoding the receptor MOR170-1 and the barcoded CRE reporter gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB-CMV expression vector
-
Backbone manufacturerSBI
- Backbone size w/o insert (bp) 8608
- Total vector size (bp) 9688
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMOR170-1
-
Alt nameOlfr895
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1080
-
GenBank IDAY073215.1
-
Entrez GeneOlfr895 (a.k.a. MOR170-1)
- Promoter TRE (Tet-On)
-
Tag
/ Fusion Protein
- LUCY tag, Rho tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTTATTGCGGTAGTTTATCACAG
- 3′ sequencing primer CTGCTGAGGAGTCTTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-MultiplexedReporter-MOR170-1 was a gift from Sriram Kosuri (Addgene plasmid # 129461 ; http://n2t.net/addgene:129461 ; RRID:Addgene_129461) -
For your References section:
A Scalable, Multiplexed Assay for Decoding GPCR-Ligand Interactions with RNA Sequencing. Jones EM, Jajoo R, Cancilla D, Lubock NB, Wang J, Satyadi M, Cheung R, de March C, Bloom JS, Matsunami H, Kosuri S. Cell Syst. 2019 Mar 27;8(3):254-260.e6. doi: 10.1016/j.cels.2019.02.009. Epub 2019 Mar 20. 10.1016/j.cels.2019.02.009 PubMed 30904378